EQUINOX LIBRARY AMPLIFICATION KITS: FAQs

• Low-frequency variant detection NGS assays, including those utilizing challenging samples such as FFPE and cfDNA
• Hybridization capture workflows
• Single-cell analysis
• Whole-genome sequencing (WGS)
• RNA-Seq
• Amplicon sequencing
• ChIP-Seq, ATAC-Seq, and associated epigenetic applications
• Illumina and non-Illumina sample preparation workflows

• Amplification of bisulfite-converted DNA
• Amplification of damaged DNA or templates containing modified bases

Equinox DNA Polymerase is an engineered B family proofreading polymerase variant developed specifically for NGS applications to deliver excellent fidelity, uniform sequence coverage, and high library complexity.

Equinox Uracil Tolerant DNA Polymerase is a proprietary proofreading polymerase specifically engineered to utilize templates that contain uracil or other modified bases. Unlike most B-family DNA polymerases, it does not stall when encountering a modified residue, thereby enabling efficient amplification and high yields of bisulfite converted and damaged DNA.

The 2X and 4X formulations of Equinox Library Amplification Master Mix result in the same final concentration of enzyme, dNTPs, and buffer components when used at 1X working concentration. However, the volume of master mix required for a standard reaction is 50% less when working with a 4X kit. This leaves more space for dilute templates. The two formulations are expected to perform the same when used with the same template according to standard recommendations.

Equinox Uracil Tolerant Library Amplification Kits can robustly amplify templates up to 10 kb in length. We have shown efficient amplification >10 kb; however, we would recommend additional optimization.

Equinox Library Amplification Kits can robustly amplify templates up to 10 kb in length. We have shown efficient amplification >10 kb; however, we would recommend additional optimization.

A highly optimized hot start antibody is used to inhibit polymerase and exonuclease activity prior to the initial denaturation (enzyme activation) step. Equinox DNA Polymerase exhibits industry-leading inhibition of both polymerase and exonuclease activity prior to activation.

Table 1: Thermocycler program settings

¹ An annealing temperature of 60°C is recommended for standard Illumina® “P5” and “P7” primers (P5: AATGATACGGCGACCACCGA; P7: CAAGCAGAAGACGGCATACGAGAT). For other amplification primers, the optimal annealing temperature should be determined empirically in an annealing temperature gradient (55°C – 70°C) experiment.

² Longer extension times may be employed to ensure efficient amplification of longer-insert libraries. A 30 sec extension is sufficient for libraries with a mode fragment size up to 500 bp; a 45 sec extension time is recommended for libraries with mode fragment sizes >500 bp. The optimal condition for each application may need to be determined empirically.

Table 2: Recommended PCR cycle numbers based on DNA input

Please contact support@watchmakergenomics.com to inquire about other Equinox polymerase variants/formulations optimized for other applications.

Yes! Watchmaker offers customer fills, packaging, concentrations, and labeling – including private label – designed to meet your unique needs. We offer flexible terms to serve organizations of any size, and our right-sized processes enable rapid turnaround time on customization. Please contact sales@watchmakergenomics.com to learn more about our capabilities.

Yes! Our Quality Management System has achieved ISO 13485:2016 Certification. Our certificate has been awarded for the design, development, manufacture, contract manufacture, and support of high performing reagents for genomics applications in medical research. Download the certificate here.