What are the main applications for the Equinox Library Amplification Kit?
- Low-frequency variant detection NGS assays, including those utilizing challenging samples such as FFPE and cfDNA
- Hybridization capture workflows
- Single-cell analysis
- Whole-genome sequencing (WGS)
- RNA-Seq
- Amplicon sequencing
- ChIP-Seq, ATAC-Seq, and associated epigenetic applications
- Illumina and non-Illumina sample preparation workflows
What are the main applications for the Equinox Uracil Tolerant Library Amplification Kit?
- Amplification of bisulfite-converted DNA
- Amplification of damaged DNA or templates containing modified bases
What type of enzyme is in the Equinox Library Amplification Kit?
Equinox DNA Polymerase is an engineered B family proofreading polymerase variant developed specifically for NGS applications to deliver excellent fidelity, uniform sequence coverage, and high library complexity.
What type of enzyme is in the Equinox Uracil Tolerant Library Amplification Kit?
Equinox Uracil Tolerant DNA Polymerase is a proprietary proofreading polymerase specifically engineered to utilize templates that contain uracil or other modified bases. Unlike most B-family DNA polymerases, it does not stall when encountering a modified residue, thereby enabling efficient amplification and high yields of bisulfite converted and damaged DNA.
What is the difference between 2X and 4X Equinox Library Amplification Master Mixes?
The 2X and 4X formulations of Equinox Library Amplification Master Mix result in the same final concentration of enzyme, dNTPs, and buffer components when used at 1X working concentration. However, the volume of master mix required for a standard reaction is 50% less when working with a 4X kit. This leaves more space for dilute templates. The two formulations are expected to perform the same when used with the same template according to standard recommendations.
Can the Equinox Library Amplification Kit amplify longer templates?
Equinox Library Amplification Kits can robustly amplify templates up to 10 kb in length. We have shown efficient amplification >10 kb; however, we would recommend additional optimization.
Can the Equinox Uracil Tolerant Library Amplification Kit amplify longer templates?
Equinox Uracil Tolerant Library Amplification Kits can robustly amplify templates up to 10 kb in length. We have shown efficient amplification >10 kb; however, we would recommend additional optimization.
What hot start mechanism is used for Equinox formulations and how well does it work?
A highly optimized hot start antibody is used to inhibit polymerase and exonuclease activity prior to the initial denaturation (enzyme activation) step. Equinox DNA Polymerase exhibits industry-leading inhibition of both polymerase and exonuclease activity prior to activation.
What are the cycling recommendations for the Equinox Library Amplification Kit?
Table 1: Thermocycler program settings
Step | Temperature (°C) | Time (sec) | Cycles |
---|---|---|---|
Initial denaturation | 98 | 45 | 1 |
Denaturation | 98 | 15 | See Table 2 |
Annealing1 | 60 | 30 | |
Extension2 | 72 | 30 | |
Final extension | 72 | 60 | 1 |
Final hold | 4-12 | Hold | – |
1 An annealing temperature of 60°C is recommended for standard Illumina® “P5” and “P7” primers (P5: AATGATACGGCGACCACCGA
; P7: CAAGCAGAAGACGGCATACGAGAT
). For other amplification primers, the optimal annealing temperature should be determined empirically in an annealing temperature gradient (55°C – 70°C) experiment.
2 Longer extension times may be employed to ensure efficient amplification of longer-insert libraries. A 30 sec extension is sufficient for libraries with a mode fragment size up to 500 bp; a 45 sec extension time is recommended for libraries with mode fragment sizes >500 bp. The optimal condition for each application may need to be determined empirically.
Table 2: Recommended PCR cycle numbers based on DNA input
Adapter-ligated DNA (ng) | PCR cycles to generate | |
---|---|---|
40 nM library | 1 µg library | |
500 | 1 | 2 |
100 | 3 | 4 |
50 | 4 | 5 |
10 | 7 | 8 |
5 | 8 | 9 |
1 | 11 | 12 |
0.5 | 12 | 13 |
0.1 | 15 | 16 |
0.01 | 18 | 19 |
0.001 | 22 | 23 |
0.0001 | 26 | 27 |
What primer concentrations are recommended for amplification with the Equinox Library Amplification Kit?
What are the recommended extension times for amplification with the Equinox Library Amplification Kit?
Besides NGS library amplification, for which applications would you recommend Equinox?
Please contact support@watchmakergenomics.com to inquire about other Equinox polymerase variants/formulations optimized for other applications.
Do you offer custom formats?
Yes! Watchmaker offers customer fills, packaging, concentrations, and labeling – including private label – designed to meet your unique needs. We offer flexible terms to serve organizations of any size, and our right-sized processes enable rapid turnaround time on customization. Please contact sales@watchmakergenomics.com to learn more about our capabilities.
Are you ISO 13485-certified?
Yes! Our Quality Management System has achieved ISO 13485:2016 Certification. Our certificate has been awarded for the design, development, manufacture, contract manufacture, and support of high performing reagents for genomics applications in medical research. Download the certificate here.