EQUINOX LIBRARY AMPLIFICATION KIT: FAQs

PRODUCTS
What are the main applications for the Equinox Library Amplification Kit?

Our Equinox Library Amplification Kit has been specifically optimized for efficient NGS library amplification from a wide range of template amounts (0.1&nbsppg – 500 ng) up to 1 kb in length. These NGS applications include:

  • Low-frequency variant detection NGS assays, including those utilizing challenging samples such as FFPE and cfDNA
  • Hybridization capture workflows
  • Single-cell analysis
  • Whole genome sequencing (WGS)
  • Amplicon sequencing
  • RNA-Seq
  • ChIP-Seq, ATAC-Seq, and associated epigenetic applications
  • Illumina and non-Illumina sample preparation workflows
What type of enzyme is in the Equinox Library Amplification Kit?

Equinox DNA Polymerase is a proprietary B family proofreading polymerase variant developed specifically for NGS applications to deliver excellent fidelity, uniform sequence coverage, and high library complexity.

Can the Equinox Library Amplification Kit amplify longer templates?
Equinox Library Amplification Kits can robustly amplify templates up to 10 kb in length. We have shown efficient amplification >10 kb; however, we would recommend additional optimization.
What is the hot start functionality of Equinox and how well does it work?
Antibody-mediated hot start functionality prevents polymerase and exonuclease activity prior to activation during the amplification step. Equinox DNA Polymerase exhibits industry-leading inhibition of both polymerase and exonuclease activity prior to activation
Does Equinox tolerate uracil residues?
Please contact support@watchmakergenomics.com for alternative Equinox polymerases which are engineered to amplify uracil-containing templates, including chemically or enzymatically bisulfite converted DNA.
What are the cycling recommendations for the Equinox Library Amplification Kit?

Table 1: Thermocycler program settings

Step Temperature (°C) Time (sec) Cycles
Initial denaturation 98 45 1
Denaturation 98 15 See Table 2
Annealing1 60 30
Extension2 72 30
Final extension 72 60 1
Final hold 4-12 Hold

1 An annealing temperature of 60°C is recommended for standard Illumina® “P5” and “P7” primers (P5: AATGATACGGCGACCACCGA; P7: CAAGCAGAAGACGGCATACGAGAT). For other amplification primers, the optimal annealing temperature should be determined empirically in an annealing temperature gradient (55°C – 70°C) experiment.

2 Longer extension times may be employed to ensure efficient amplification of longer-insert libraries. A 30 sec extension is sufficient for libraries with a mode fragment size up to 500 bp; a 45 sec extension time is recommended for libraries with mode fragment sizes >500 bp. The optimal condition for each application may need to be determined empirically.

Table 2: Recommended PCR cycle numbers based on DNA input

Adapter-ligated DNA (ng) PCR cycles to generate
40 nM library 1 µg library
500 1 2
100 3 4
50 4 5
10 7 8
5 8 9
1 11 12
0.5 12 13
0.1 15 16
0.01 18 19
0.001 22 23
0.0001 26 27
What primer concentrations are recommended for amplification with the Equinox Library Amplification Kit?
Always use equimolar concentrations of forward and reverse primers at a final concentration of 0.5 to 2 µM each. A final concentration of 0.5 µM is sufficient to yield 500 ng of library (approximately 40 nM in a 50 µL reaction for a library with an average fragment length of 400 bp). If the total library yield must exceed 500 ng or 40 nM, use 2 µM final concentration. If you need more specific recommendations for primers, please contact support@watchmakergenomics.com.
What are the recommended extension times for amplification with the Equinox Library Amplification Kit?
A 30 sec extension is sufficient for libraries with a mode fragment size up to 500 bp. Longer extension times may be required to ensure efficient amplification of longer-insert libraries.
Besides NGS library amplification, for which applications would you recommend Equinox?
Please contact support@watchmakergenomics.com for alternative Equinox polymerases optimized for a variety of applications including gene assembly, multiplex PCR, and uracil-tolerant PCR.